msmR [2019-05-30 17:47:01]

transcriptional regulator of the melR-melE-melD-melC-melA operon

Locus: BSU30260

Isoelectric point: 6.45

Molecular weight: 38.24 kDa

Protein length: 344 aa

Gene length: 1035 bp

Function: regulation of melibiose utilization

Product: transcriptional regulator (LacI family)

Essential: no

Synonyms

Genomic Context

Loading

Categories containing this gene/protein

• Metabolism → Carbon metabolism → Utilization of specific carbon sources → Utilization of melibiose
• Information processing → Regulation of gene expression → Transcription factors and their control → Transcription factors/ other

Gene

Coordinates: 3,096,782 3,097,816

The protein

Protein family

• LacI family

Structure

• 1VPW (E. coli PurR, 29% identity) PubMed

Expression and Regulation

Operons

• Genes: melR-melE-melD-melC-melA
  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in SigA regulon

  Regulatory mechanism

  • CcpA: repression, PubMed, in CcpA regulon
  • MelR: repression, PubMed, in MelR regulon

  Regulation

  • induced by melibiose or raffinose (MelR) PubMed
  • repressed by glucose (CcpA) PubMed
  • there is an additional RNA "upshift" signal in front of the melE gene suggestive of a melE-melD-melC-melA mRNA PubMed. However, there is no promoter in front of melE, suggesting that this mRNA may be the product of mRNA processing PubMed

Biological materials

Mutant

• MGNA-A802 (msmR::erm), available at the NBRP B. subtilis, Japan
• BKE30260 (melR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGGTATCCCTCTCATCT, downstream forward: _UP4_TAAGCAAAGATTCATCACGA
• BKK30260 (melR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGGGTATCCCTCTCATCT, downstream forward: _UP4_TAAGCAAAGATTCATCACGA

References

Loading